7. How do I prove that I was in class the very first day? …
7. How do I prove that I was in class the very first day? A. By showing up in person in the classroom designated in the syllabus B. By calling the professor by phone and announcing that I am enrolled in the class C. By doing nothing until the first exam D. By emailing the professor and announcing to him that I am enrolled in the class
Read DetailsA non-safe harbor 401(k) plan allows plan participants the o…
A non-safe harbor 401(k) plan allows plan participants the opportunity to defer taxation on a portion of regular salary simply by electing to have such amounts contributed to the plan instead of receiving them in cash. Which of the following statements are rules that apply to 401(k) salary deferrals? 1. Salary deferral into the 401(k) plan is limited to $24,500 for individuals younger than 50 for 2026.2. A non-discrimination test called the actual deferral percentage test applies to salary deferral amounts.
Read DetailsFirst Written Response Question: As described in Chapter 3 o…
First Written Response Question: As described in Chapter 3 of the textbook, please name and describe three environmental factors that could affect labour relations. Please indicate which you feel is potentially most impactful and explain why.
Read DetailsMechanisms of DNA Damage and Repair-Professor Dave explains…
Mechanisms of DNA Damage and Repair-Professor Dave explains the chapterhttps://www.youtube.com/watch?v=sX6LncNjTFUA normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)Include in your answer:The start codon (AUG)Divide the sequence into codons (groups of three)Translate each codon with codon tableTranslate the mutant mRNA the same wayCompare the original and mutated proteins: lengths, differences, and premature stopExplain impact: Functional or non-functional proteinCodon Table: https://woodmontcollege.edu/moodle/pluginfile.php/289807/mod_resource/content/1/Codon_Table.pdf
Read Details