Gene Structure and Expression (25 pts)

What is the function of what is labeled “Ori” or “Origin” in a bacterial plasmid?

If an organism is diploid, and has 16 chromosomes in total, how many sets of homologous chromosomes does it possess?

The primary advantage of sexual reproduction is that is fosters greater genetic diversity than does asexual reproduction.  Name three distinct things that generate genetic diversity in sexually reproducing organisms (and are unique this mode of reproduction).

The N terminus of this oligopeptide is [N-terminus].     The C terminus of this oligopeptide is [C-terminus]

Forward primer 5’ AAGCTTATGGCCGGCCCCAGCCTCGC     (with added HindIII linker) Reverse primer 5’ GAATTCTCAGCGCTGGGAGAAGGTGG     (with added EcoRI linker) Figure.  The primers used in the polymerase chain reaction.  Target-matching section of the primer is underlined.  The added recognition sequence and and cut site for one of two restriction enzymes is shown in italics.   What is the purpose of the 12 italicized nucleotides (that aren’t complementary to the target DNA!) at the 5’ of each of the primers shown above?

You isolate mRNA from the pituitary gland and hypothalamus from the brain of a recently deceased (dead) man.  From this you intend to make cDNA. What enzyme would you use first to create the first strand of cDNA from the mRNA?

Identify ALL of the alpha carbons.

There are 5 sections of this exam with 30 questions total.  Please ask questions of your instructors if needed.  No other outside help (neighbors, notes, online resources) is allowed.   Do your best.  You’ve got this.

What should package labels include?