Non-ionizing radiation can disinfect by causing ___.

Specificity, or the ability to react uniquely to a particular protein structure, is a feature of which of the following?

Chloroplasts have their own DNA. Which other organelle in a plant cell has its own DNA?

What is genetic drift? 

From an evolutionary perspective, germ-line mutations are more significant than somatic mutations. This is because ________.

You are a doctor examining a patient’s blood test results. The patient’s T cell count is low, and T cells that are present are not well-developed. You are concerned that the patient will ________.

Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  Where would the start codon be located along strand K/L? Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC

______________ are comprised on microtubules and facilitate bacterial phototaxis or chemotaxis.

In the context of meiosis, homologous chromosomes can be defined as ________.

Which of the following is not one of the major differences between RNA and DNA?