What are the major post-transcriptional modifications that happen to eukaryotic RNA before it is released as mRNA? (Mark all that apply.)

Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  What direction would be considered upstream? (This DNA is written according to standard conventions.) Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC

The active maintenance of a constant environment is referred to as ________.

Which of the following is not an essential element of cell communication?

Leaves absorb the least amount of light in the ________ range of the visible spectrum.

Endogenous infectious agents arise from microbes that are:

An individual is born with a mutation such that they cannot form MAC proteins that associate with one another in a plasma membrane. This is an example of ________.

Innate immunity is different from adaptive immunity in that ________.

Paralytic shellfish syndrome can cause ___ due to saxitoxin, a potent neurotoxin. 

In which phase of the cell cycle is the DNA replicated?