CHOOSE THE BEST ANSWERS In a population of cows, a single gene controls hair type. The curly hair allele (H) shows incomplete dominance with the straight hair allele (h). The hair of heterozygous individuals (Hh) is wavy. Another gene controls coat color. The red (R) and white (r) alleles are co-dominant. The coloring of heterozygous individuals (Rr) is called roan [pictured below]. After breeding a wavy, roan bull with several wavy, roan females, you observed the following phenotypic ratio in the offspring: 1 curly, red : 2 wavy, roan :  1 straight, white Based on this observed ratio,  are the two genes linked? [true_false] If they are linked, what way are the alleles of the two genes linked? [answer1]  

CHOOSE THE BEST ANSWER During DNA replication, our cells use the enzyme helicase to “unzip” the two strands that comprise the DNA molecule. To make copies of specific DNA sequences in the lab, scientists use polymerase chain reaction (PCR).  PCR mimics DNA replication in some ways, but not in how the two strands are pulled apart. How are the two strands of DNA unzipped in the lab during PCR? 

CHOOSE THE BEST ANSWER “Splicing” is one way eukaryotic organisms like humans regulate gene expression. What is involved in the process of splicing?

CHOOSE THE BEST ANSWER What is the relationship between the terms “genotype” and “phenotype”?

CHOOSE THE BEST ANSWER The building blocks of DNA are nucleotides. The four nucleotides of DNA are commonly referred to by the first letter of its full name: A, T, C, and G. What component of a nucleotide gives its unique characteristics and corresponds to its shortened name?

CHOOSE THE BEST ANSWER FOR EACH QUESTION Researchers hypothesize that glucosamine reduces joint pain and increases agility in senior dogs. They design an experiment to test their hypothesis where they give 50 senior dogs a 1000 mg glucosamine supplement a day and another group of 50 senior dogs a placebo without glucosamine. Every day for a month, all dogs will be measured and timed on a simple agility run. Results will then be compared between groups to determine how effective the treatment was. In this experiment: what was the dependent variable? [dependent1] what was the independent variable? [independent1]

CHOOSE THE BEST ANSWER A mother and her two daughters each develop breast cancer at approximately the same age in their lives. Based on genetic analysis, it is determined that mutations in the BRCA1,  tumor suppressor gene, is responsible for all three instances of cancer. Their specific mutations are presented below (bold base pair). Mother: ATCGCTCCADaughter A: ATCGCTCCADaughter B: ATCGCTCCA Given these data, what is the most likely origin of each daughter’s cancer? Daughter A’s cancer is [answer1] Daughter B’s cancer is [answer2]

CHOOSE THE BEST ANSWERS Imagine your hair color is determined by one gene with two alleles. Both of your parents have brown hair (dominant), but you have blonde hair (recessive). What are your parents’ genotypes based on the information above?

CHOOSE THE BEST ANSWER Alleles are alternate versions of _____ gene(s) that have ____ nucleotide sequences.

CHOOSE THE BEST ANSWER Foxes The Arctic fox (Vulpes lagopus) and the fennec fox (Vulpes zerda) both belong to the same genus but inhabit vastly different environments—one in the Arctic and the other in the Sahara desert. On the other hand, the Corsac fox (Vulpes corsac) and the Cape fox (Vulpes chama) live in semi-arid habitats in Central Asia and South Africa, respectively. You sequence one gene present in all four species and obtain the following results: Arctic fox: TCGGATCAGGACTACCTAGACape fox: TTGGGTGAGGATTGCGTATACorsac fox: TCGGATCAGGACTACTTAAAFennec fox: TTGGGTGAGGATCGCATATT Based on the data, which species is most closely related to the Arctic fox?