Kangaroo rats (actually they are a type of mouse) from the deserts of the southwestern United States look nearly identical to jerboas (also mice) from the deserts of Africa.  You sequence one gene present in both species, as well as the same gene in the U.S. pocket mouse and the African jumping mouse.  You obtain the following results: pocket mouse: GGACGCAGATCATTAGGACTjumping mouse: GGATCGAGATCTGTCGAACTkangaroo rat: GGACCCAGATCAGTAGGACTjerboa:   GGATCCAGATCTGTCGGAGT Based on the data, which species is most closely related to the pocket mouse?

Which is a unit of mass in the metric system?

During the last thee hundred years, the growth of the human population has been

The prefix in the metric system denoting 0.01 is called what?

When listing siblings using the listing principle, the list must be organized in ____________________________.

In ASL, things, such as living situation, are discussed ________________________________________.

In Zora Neale Hurston’s essay “How It Feels to Be Colored Me,” where did Hurston grow up?

Why did the late nineteenth century earn the name “the Gilded Age” in the United States?  

Read each passage carefully. For each one, identify (1) the title of the work and (2) the author. Your answers must be complete and spelled correctly to receive full credit.  “He’s not the finest character that ever lived. But he’s a human being, and a terrible thing is happening to him. So attention must be paid. He’s not to be allowed to fall into his grave like an old dog.”

In Robert Frost’s “Mending Wall,” what repeated proverb does the neighbor use?