GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

Author Archives: Anonymous

Meier-Gorlin syndrome results from flaws in the licensing of…

Meier-Gorlin syndrome results from flaws in the licensing of origins in replication. Which is the most likely effect on DNA replication in effected individuals?

Read Details

For a given gene, both strands of a DNA are used as a templa…

For a given gene, both strands of a DNA are used as a template simultaneously from one initiation point when which of the following molecules is synthesized?

Read Details

Which of the following molecules is synthesized using nucleo…

Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil?

Read Details

Prokaryotic promoters contain the sequence TATAAT at a posit…

Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start.

Read Details

A key modification in the 3 end of eukaryotic mRNA is the a…

A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?

Read Details

Assume a DNA molecular, with the primary structure listed be…

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, how many 3´ hydroxyls are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

Read Details

Which of the following statements is TRUE of DNA polymerases…

Which of the following statements is TRUE of DNA polymerases of eukaryotic cells?

Read Details

In the diagram below, which letter indicates the 5’ end of t…

In the diagram below, which letter indicates the 5’ end of the leading strand?  

Read Details

What types of bonds are created between adjacent ribonucleot…

What types of bonds are created between adjacent ribonucleotides during the process of transcription?

Read Details

Indicate which of the following statements is TRUE.

Indicate which of the following statements is TRUE.

Read Details

Posts pagination

Newer posts 1 … 74,203 74,204 74,205 74,206 74,207 … 83,083 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top