If the following piece of double-stranded DNA is transcribed, using the TOP strand as the template strand, what would be the RNA molecule produced?   5’TCCGCAACACTGT3′ 3’AGGCGTTGTGACA5′

In Bacteria and Archaea, the Ribosome Binding Site is [blank1] the start codon. The first amino acid in the protein is specified by [blank2]. 

Bacterial RNA [answer1] all have a ribosome binding site. This [answer2] true of Archaea. By contrast, in general  [answer3] of eukaryal nuclear transcripts have a ribosome binding site. 

True/False. Termination of translation is signaled by the binding of release factors to the E site.

During DNA replication, there is typically [answer1] DNA polymerase complexes at the replication fork and [answer2]  helicase complexes. 

True/False. Upon peptide bond formation, an amino acid or peptide is transferred from a tRNA in the P site to an amino acyl-tRNA in the A site.

Consider the following mRNA sequence, where the AUG indicates a start codon for translation:  5′ AAUUCGAAUGGUCCUCGGCUCGCUAUCA 3′ When the UCG codon is in the E site, what codon will be in the A site? For your answer, write only the codon in the blank, written from 5′ to 3′ direction, but do NOT add 5′ or 3′ or any punctuation. So your answer should just be something like : GGG  

If the following piece of double-stranded DNA is transcribed, using the TOP strand as the template strand, what would be the RNA molecule produced?   5’ACCGTGACACGT3′ 3’TGGCACTGTGCA5′

For the following DNA template sequence, what would be the sequence of the daughter strand synthesized during DNA replication?  5’GACGTGCACGCG 3’  

True/False. All bacterial and archaeal chromosomes are circular.