Consider the following sequence and explain what effect the mutation has on the protein that is translated.   UCUAUGUUUCACAGAGGGAAACCCUAACCC (normal)   UCUAUGUUUCACAGCGGGAAACCCUAACCC (mutant)

The two strands of a chromosome double helix are joined to each other through _____.

Portions of mRNA called __________ are removed and the remaining __________ are spliced together to produce an mRNA molecule with a continuous coding sequence.

Most human cancers are _____.

What controls the way in which a zygote differentiates (divides and specializes into different cell and tissue types)?

Promoters are:

Insulin used for the treatment of diabetes in humans is now obtained from _____.

What nucleotide sequence would be found on the complementary DNA strand of the strand shown here?

Explain the role of proto-oncogenes and tumor-suppressor genes in cancer. (5 pts)      

A rabbit population consists of animals that are either very dark on top or very light on top. When examining them closely, biologists were surprised to find no rabbit with a medium darkness, intermediate to the two extremes. This is an example of