A 29-year-old computer programmer comes to your office for evaluation of a headache. The tightening sensation is located all over the head and is of moderate intensity. It used to last minutes, but this time it has lasted for 5 days. He denies photophobia and nausea. He spends several hours each day at a computer monitor/keyboard. He has tried over-the-counter medication; it has dulled the pain but not taken it away. Based on this description, what is your most likely diagnosis?

Which of the following is a symptom involving the eye?

A 50-year-old body builder is upset by a letter of denial from his life insurance company. He is very lean but has gained 2 pounds over the past 6 months. You personally performed his health assessment and found no problems whatsoever. He says he is classified as “high risk” because of obesity. What should you do next?

A 55-year-old bank teller comes to your office for persistent episodes of dizziness. The first episode started suddenly and lasted 3 to 4 hours. He experienced a lot of nausea with vomiting; the episode resolved spontaneously. He has had five episodes in the past weeks. He does note some tinnitus that comes and goes. Upon physical examination, you note that he has a normal gait. The Weber localizes to the right side and the air conduction is equal to the bone conduction in the right ear. Nystagmus is present. Based on this description, what is the most likely diagnosis?

A 30-year-old sales clerk comes to your office wanting to lose weight; her BMI is 30.0 kg/m2. What is the most appropriate amount for a weekly weight reduction goal?

Despite having high BP readings in the office, Mr. Kelly tells you that his readings at home are much lower. He checks them twice a day at the same time of day and has kept a log. How do you respond?

A 58-year-old man comes to your office complaining of bilateral back pain that now awakens him at night. This has been steadily increasing for the past 2 months. Which one of the following is the most reassuring in this patient with back pain?

Mrs. Fletcher complains of numbness of her right hand. On examination, sensation of the volar aspect of the web of the thumb and index finger and the pulp of the middle finger are normal. The pulp of the index finger has decreased sensation. Which of the following is affected?

Mrs. Anderson presents with an itchy rash which is raised and appears and disappears in various locations. Each lesion lasts for many minutes. What most likely accounts for this rash?

The mRNA sequence below contains nucleotides that encode the first amino acids of the protein made by the nuclear fallout (nuf) gene in Drosophila: 5’-GUAAAUCAUGAGUAGUCAACCUGCCAGC…-3’        wildtype nuf mRNA  What are the first five amino acids encoded by this mRNA (use three letter abreviations given in the codon table below)?     You isolate a nuf gene mutant and determine the base sequence of the mutant mRNA: 5’- GUAAAUCAUGAGUAGUAAACCUGCCAGC…-3’        mutant nuf mRNA What are the first five amino acids encoded by this mRNA (use codon table below)?    Is the mutation in the gene a transition, transversion, insertion, or deletion?    In the wildtype sequence below, identify a single base pair change that would lead to an early stop (nonsense mutation). Which nucleotide would you change (A-E)? What nucleotide would you change it to (A, T, G or C)?