Which type of mutation changes a single amino acid in a translated polypeptide?

The bacterial genes that encode repressor proteins are sometimes near to and sometimes distant from the operons they regulate. Why are they able to function in either case?

During translation elongation, one end of the growing polypeptide chain emerges from the ribosome while the other is attached to a tRNA. Which end of the polypeptide emerges?

Shown is a gene being simultaneously transcribed by multiple RNA polymerase enzymes. Where is the location of this gene’s promoter?

Which of the following statements about transcription is NOT true?

Despite having ~20,000 protein coding genes, translation in human cells produces ~100,000 polypeptides. How is this possible?

Based on the provided genetic code and your knowledge about the initiation and termination of translation, what would be the second and last amino acids of the polypeptide produced from the mRNA shown below?5’ CCCUCGAUGGUCUUAGCGUAGCGCU 3’

Which of the following indicates the relative rates of transcription of the lac operon for E. coli with access to abundant source(s) of the following of sugar(s): lactose only, glucose only, lactose and glucose. To be clear, transcription rates in answers are as highest > intermediate > lowest.

The transcript produced from an operon is ______.

The most common problem created by a mutation that duplicates a portion of a chromosome is ________.