The synthesis of the daughter strand of DNA occurs away from the replication fork in the leading strand.

What enables the splicing of self-splicing RNAs?

In eukaryotic organisms, the processing of the 45S rRNA into 5.8S, 18S, and 28S rRNA occurs where?

Which of the following codons is NOT degenerate to CUU?

If translation begins at the first start codon and ends at the first in frame stop codon, how many amino acids are encoded by the following mRNA?  5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′  

Which describes the mechanism of hypothetical DNA replication in which both parental strands remain together following replication? Note: this was one of the models proposed, but research discovered a different mechanism. 

The genetic code — the correspondence between codons and amino acids — is unique for each species of organism.

In transcription, the closed complex consists of (choose all that apply)

You are conducting an inspection on Patient A, B  and C for suspected shoulder injuries. Describe the deformity you see on each patient and what is the suspected Dx for each? A.   B.   C.

All of the following are examples of post-operative effects of sedation that patients may experience EXCEPT one.  Which one is the EXCEPTION?