What would be the sequence of the anticodon of the tRNA that first binds to the mRNA during translation?

(Still putting the events of transcription in the correct order.) Third…

The remaining questions refer to the following DNA sequence: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’ You will need to transcribe and translate the DNA sequence to answer these questions. You should CAREFULLY write down this sequence on a piece of scrap paper so you can do the transcription and translation. A BIOL 190 student transcribed the DNA sequence above and gave an answer of: TTTAAGTGGATGTACCGCAACGCGCTTACGATCTTATGGCGAGAGTAATCTTTAGTTTAG Is this correct?

What is the function of the methyl cap on a mature mRNA?

During translation, ______ is  produced from the information in ______.

During which phase of the cell cycle is DNA synthesized? 

What is hydrogen bonding?

The nucleotide sequences on DNA that actually have information encoding a sequence of amino acids are: 

Long stretches of repeated nucleotides on the ends of linear eukaryotic chromosomes are called

Fats composed of fatty acids that have double bonds in the fatty acids and have fewer than the maximum number of hydrogen atoms are: