Part 2: Review Questions from Weeks 1-8

How many clades are on this tree? Assume: The tips of the tree each represent a species.

By signing my name below I attest that I have not received nor given help on this exam to anyone else. Nor have I used resources outside of my own brain on this exam.

What would result from a single nucleotide deletion (point mutation) in the middle of the coding sequence of a structural gene?

Which parts of the nucleotide-excision repair mechanism assist in the physical cutting and removal of nucleotides? I.       UvrAII.      UvrBIII.     UvrCIV.     UvrD

Essay A. All four mechanisms of evolution (mutation, migration, genetic drift, and natural selection) that we have discussed influence speciation.  Choose 3 of these mechanisms and for each describe (a) whether it helps or hinders speciation (or both) and (b) why it has that particular impact on speciation.

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?   Normal gene: ATGGCCGGCCCGAAAGAGACC          Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr          Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

4A. (8 pts) Match the definitions with the appropriate type of bias or effect shown on the right.

How many synapomorphies are on this tree? Assume the tips of this tree each represent a species.

Which of the following is directly involved in splicing mRNAs?