Essay A. All four mechanisms of evolution (mutation, migrati…
Essay A. All four mechanisms of evolution (mutation, migration, genetic drift, and natural selection) that we have discussed influence speciation. Choose 3 of these mechanisms and for each describe (a) whether it helps or hinders speciation (or both) and (b) why it has that particular impact on speciation.
Read DetailsBased on the gene and protein sequences that follow, what ty…
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
Read Details