The site in the ribosome that accepts new, charged amino actyl tRNAs is called the 

Which process creates a genetically identical daughter cell with the same number of chromosomes?

Select all bases from the list that are purines

the adding of bases to the 3′ hydroxyl by DNA polymerase III  best describes the [step] step of [process]

During which process are two gametes united to form a zygote?

Making protein from the information contained in mRNA is known as

For the following Free response consider this the template strand: 5′ CTTAGAGTCCTCAGTCCACGTGCATGT 3′

The major pigment used in photosynthesis is

DNA replication  is best described as

The site of glycolysis is the