Phase of the cell cycle in which the cell completes its preparations for division.

Crowded cells that stop dividing are demonstrating:

Which cell is in interphase?  

Which of the following are mechanisms of increasing cellular efficiency?

The first proteins to bind to the promoter during transcription.

The form of chromatin seen in chromosomes during mitosis.

How would the effect of the mutation described in the previous question be classified?

What would be the sequence of the anticodon of the tRNA that first binds to the mRNA during translation?

(Still putting the events of transcription in the correct order.) Third…

The remaining questions refer to the following DNA sequence: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’ You will need to transcribe and translate the DNA sequence to answer these questions. You should CAREFULLY write down this sequence on a piece of scrap paper so you can do the transcription and translation. A BIOL 190 student transcribed the DNA sequence above and gave an answer of: TTTAAGTGGATGTACCGCAACGCGCTTACGATCTTATGGCGAGAGTAATCTTTAGTTTAG Is this correct?