DNA Sequence Chart For questions 62–65, use the following DNA sequence and diagram.5’ TAGAATGCGCCTACGTCGATAA 3’3’ ATCTTACGCGGATGCAGCTATT 5’ Image Description A detailed genetic code table, which is a critical reference in molecular biology for understanding how genetic information in DNA and mRNA sequences is translated into proteins. The table is organized into four columns and four rows, with each cell containing a three-letter codon corresponding to either an amino acid or a stop signal. The first column and row are labeled with the nucleotides U (uracil), C (cytosine), A (adenine), and G (guanine). Each codon is listed with its designated amino acid, for example, “UUU (phenylalanine)” or a stop signal as in “UAA (stop).” The colors—purple, green, yellow, and blue—differentiate between the four starting nucleotides of the codons. A key amino acid, “AUG (methionine or start),” is highlighted as the common starting point for protein synthesis. This table is a standard tool for geneticists, providing the essential code for translating nucleotide sequences into the amino acid sequences of proteins. Codons and the corresponding amino acids: U UU UUU (phenylalanine) UUC (phenylalanine) UUA (leucine) UUG (leucine) UC UCU (serine) UCC (serine) UCA (serine) UCG (serine) UA UAU (tyrosine) UAC (tyrosine) UAA (stop) UAG (stop) UG UGU (cysteine) UGC (cysteine) UGA (stop) UGG (tryptophan) C CU CUU (leucine) CUC (leucine) CUA (leucine) CUG (leucine) CC CCU (proline) CCC (proline) CCA (proline) CCG (proline) CA CAU (histidine) CAC (histidine) CAA (glutamine) CAG (glutamine) CG CGU (arginine) CGC (arginine) CGA (arginine) CGG (arginine) A AU AUU (isoleucine) AUC (isoleucine) AUA (isoleucine) AUG (methionine or start) AC ACU (threonine) ACC (threonine) ACA (threonine) ACG (threonine) AA AAU (asparagine) AAC (asparagine) AAA (lysine) AAG (lysine) AG AGU (serine) AGC (serine) AGA (arginine) AGG (arginine) G GU GUU (valine) GUC (valine) GUA (valine) GUG (valine) GC GCU (alanine) GCC (alanine) GCA (alanine) GCG (alanine) GA GAU (aspartic acid) GAC (aspartic acid) GAA (glutamic acid) GAG (glutamic acid) GG GGU (glycine) GGC (glycine) GGA (glycine) GGG (glycine)

There is a protein in cells that you find functions as a transcription initiator protein in prokaryotes. This protein X will bring the RNA polymerase to the promoter sequence of a gene. This protein is most likely a ________.

Sometimes atoms gain or lose particles. The loss of which of the following would result in a change of overall electrical charge? (Mark all that apply.)

When you run a gel, how long are the fragments of DNA at the bottom of the gel generally?

If a mutation rendered the signal recognition particle nonfunctional, what would be the most obvious effect on the cell?

Non-virulent bacteria can be prevented from being transformed into virulent bacteria if the debris from heat-killed virulent bacteria is first treated with ________.

Non-virulent bacteria can be prevented from being transformed into virulent bacteria if the debris from heat-killed virulent bacteria is first treated with ________.

Assuming the RNA polymerase hasn’t encountered a start codon yet, what would be the fifth amino acid translated after the start codon?

What is the result of meiosis?

Anabolic pathways of metabolism are pathways that ________.