Which of the following is a/are way(s) for allopatric speciation to occur? Movement of a segment of a population to a new island Polyploidy Geographic separation, such as two populations on either side of a mountain range  

Please hold your scratch paper up to your camera.  Show both sides.  At the end of this exam you need to destroy your scratch paper.  Sharing any answers or notes you’ve taken during the exam  with other students will be considered academic dishonesty.

Kangaroo rats (actually they are a type of mouse) from the deserts of the southwestern United States look nearly identical to jerboas (also mice) from the deserts of Africa.  You sequence one gene present in both species, as well as the same gene in the U.S. pocket mouse and the African jumping mouse.  You obtain the following results: pocket mouse: GGACGCAGATCATTAGGACTjumping mouse: GGATCGAGATCTGTCGAACTkangaroo rat: GGACCCAGATCAGTAGGACTjerboa:   GGATCCAGATCTGTCGGAGT Based on the data, which species is most closely related to the pocket mouse?

Which is a unit of mass in the metric system?

During the last thee hundred years, the growth of the human population has been

The prefix in the metric system denoting 0.01 is called what?

When listing siblings using the listing principle, the list must be organized in ____________________________.

In ASL, things, such as living situation, are discussed ________________________________________.

In Zora Neale Hurston’s essay “How It Feels to Be Colored Me,” where did Hurston grow up?

Why did the late nineteenth century earn the name “the Gilded Age” in the United States?