What did Dr. O’Neill say was one of the most important scientific discoveries in the last century for human health?

Refer to the graph and info for questions 39–42. Image Description  A stepwise graph, also known as an energy diagram depict changes in free energy (ΔG) as a reaction proceeds from start to finish. The y-axis is labeled as ‘free energy (kcal/mol)’ and the x-axis represents ‘time’, suggesting the progression of a chemical reaction. Five distinct stages are marked along the graph’s course with the letters A to E, each representing a different energy state within the reaction. The graph begins at a point labeled ‘A’ below the baseline, indicating an exothermic reaction initiation, rises to ‘B’, then to a higher point ‘C’, drops to ‘D’, and finally goes up again to ‘E’, indicating the end of the reaction. The stepwise nature suggests that there are intermediate stages or transition states that the reaction passes through before reaching completion. In a metabolic pathway, a series of enzymatic reactions catalyzes the conversion of molecule A to molecule E. Several intermediate steps are involved in which the product of one reaction becomes the substrate for the next. The graph illustrates the changes of free energy that occur at each step in the pathway.

You are a doctor, and a patient suffering from severe diarrhea and dehydration comes to see you. Which of the following diseases would this patient most likely have?

What is Hardy Weinberg’s equation?

Specificity, or the ability to react uniquely to a particular protein structure, is a feature of which of the following?

Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  Where would the start codon be located along strand K/L? Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC

Which of the following blots detects the presence of proteins?

You are a doctor examining a patient’s blood test results. The patient’s T cell count is low, and T cells that are present are not well-developed. You are concerned that the patient will ________.

Chloroplasts have their own DNA. Which other organelle in a plant cell has its own DNA?

If a mutation rendered the signal recognition particle nonfunctional, what would be the most obvious effect on the cell?