With regard to humans, the term “ecological footprint” refers to

Chloroplasts in plant cells are thought to be derived from

A P generation cross was made between a true-breeding plant with purple flowers and a true-breeding plant with white flowers. All of the F1 offspring had purple flowers. If the F1 offspring were self-fertilized, what is the expected F2 phenotypic ratio?

In island biogeography, larger islands support ______ species than smaller islands.

The net reproductive rate of a population depends on: age-specific survivorship age-specific fertility population density

Which of the following type of organism arose first?

Which of the following is a/are way(s) for allopatric speciation to occur? Movement of a segment of a population to a new island Polyploidy Geographic separation, such as two populations on either side of a mountain range  

Please hold your scratch paper up to your camera.  Show both sides.  At the end of this exam you need to destroy your scratch paper.  Sharing any answers or notes you’ve taken during the exam  with other students will be considered academic dishonesty.

Kangaroo rats (actually they are a type of mouse) from the deserts of the southwestern United States look nearly identical to jerboas (also mice) from the deserts of Africa.  You sequence one gene present in both species, as well as the same gene in the U.S. pocket mouse and the African jumping mouse.  You obtain the following results: pocket mouse: GGACGCAGATCATTAGGACTjumping mouse: GGATCGAGATCTGTCGAACTkangaroo rat: GGACCCAGATCAGTAGGACTjerboa:   GGATCCAGATCTGTCGGAGT Based on the data, which species is most closely related to the pocket mouse?

Which is a unit of mass in the metric system?