Using 800 J of work, a toy elevator is raised from the ground floor to the second floor in 20 s. How much power does the elevator use?

  In white horses: is the P1 allele dominant or recessive when it comes to coat color?

All of Martha’s offspring must be sinistral:

A flask brim filled with water is on a weighing scale. If you float a piece of wood in it, after spillage away from the scale, the scale reading will be ____________

The process of convection occurs in ______________

Snail shell coiling is an example of Maternal Effect. Dextral protein (D-) causes right (dextral) coiling of the shell and is dominant to the absence of dextral protein (dd) which causes left (sinistral) coiling.  Martha is a pet snail and she has a sinistral shell.  Answer Questions 6–10. Indicate which statements are true and which are false.

A freight car with mass (mA) of 5000-kg crashes into a freight car with mass (mB) of 10,000-kg at rest. They couple upon collision and move with a speed (vf) of 2 m/s. What was the initial speed  (vAi) of the 5000-kg freight car?

Given the same template strand DNA sequence as before, what would be the effect (on the amino acid sequence) of a G to T substitution mutation at position #11 in the DNA sequence? 3′          GTTACTGAACGTCCTGGGACGCCATC              5′

When you simultaneously drop a light tennis ball and a heavy bowling ball from a same height, they hit the floor ____________ (Air resistance acting on both falling objects is negligible)

A freight train rolls along a track with considerable momentum. If it rolls at the same speed but has twice as much mass, its momentum is __________