Given the same template strand DNA sequence as before, what would be the effect (on the amino acid sequence) of a G to T substitution mutation at position #11 in the DNA sequence? 3′          GTTACTGAACGTCCTGGGACGCCATC              5′

When you simultaneously drop a light tennis ball and a heavy bowling ball from a same height, they hit the floor ____________ (Air resistance acting on both falling objects is negligible)

A freight train rolls along a track with considerable momentum. If it rolls at the same speed but has twice as much mass, its momentum is __________

Monosomic:   

Value for χ2:   

When Danny Diver who weighs 500 N steps off a diving board 10 m above the water, he hits the water with kinetic energy of _____________

Which of the following has the largest momentum relative to Earth? 

The unit kilowatt-hour is a unit of [Answer1] and Joules is a unit of [Answer2]

According to Newton, the closer gravitationally interacting objects are to each other, the _____________    

According to the impulse-momentum relationship Ft = change in mv, a falling baseball hits a player with a force F. The t in the equation is the time [Answer]