Which class of model is potentially affected by ties?

Which of the following is the regression equation for failure time in an accelerated failure time model? Equation A:

Suppose the survival curve for a control group is less than or equal to that of a treatment group in a study. What does this imply about the cumulative hazard and hazard functions? Cumulative hazard: [ch] Hazard: [h]

Kaplan-Meier and Nelson-Aalen are

For a well-fitting model, the Cox-Snell residuals follow which distribution?

“Les, a minor, enters into a contract to buy a dirt bike from Motocross LLC. Les can ordinarily disaffirm the contract”

Prognosis Inc. owns a brain-computer interface that enables physicians to diagnose and treat some diseases quickly and accurately. Federal copyright protection extends to

“Cold Play Corporation makes snowmobiles. Dale is injured when a defect unexpectedly accelerates the Cold Play vehicle he is driving, and he is thrown off. Esty, a hiker standing in the path of the unmanned vehicle, is struck and injured. In a suit based on strict product liability, Cold Play may be liable to”

The sequence below represents the complete mRNA for a very short gene.  5’ – ACUGGUAUGCAUAUCCUUCUAUGAACGUAA – 3  (wild type sequence)   A mutation has occurred – the A at position 11 has converted to a C 5’ – ACUGGUAUGCCUAUCCUUCUAUGAACGUAA – 3  (wild type sequence)   In your own words, describe what the consequence of this mutation would be for the amino acid sequence in the protein.  In your answer you should explain whether this is a missense, nonsense, frameshift, or silent mutation. 

In the Meselson–Stahl experiment (DNA replication), cells were first grown in media continihg ‘heavy’ nitrogen(N15 radioactive).  The cells were then switched to growth in media containing ‘light (normal N14, non radioactive). Which observation ruled out the conservative model of DNA replication?