Long stretches of repeated nucleotides on the ends of linear eukaryotic chromosomes are called

Fats composed of fatty acids that have double bonds in the fatty acids and have fewer than the maximum number of hydrogen atoms are: 

The leading strand is built __________ the replication fork and the lagging strand is built __________ the replication fork.

Which pairing is incorrect? 

The process of using and transforming energy is known as: 

How would the mutation in the previous question change the polypeptide?

The mRNA has a three-nucleotide sequence called a _________, while the molecule transporting the amino acid has a complementary sequence called a(n) _______________. 

If one strand of a DNA molecule runs in a 5´à 3´, then the other strand will run in a __________ direction.

In a chemical reaction, the bonds of the __________ are broken and the atoms are rearranged to form the ___________.

What would happen, if anything, to the mRNA sequence if the A at position 13 on the DNA sequence was changed to a G by a point mutation?  Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’