CHOOSE THE BEST ANSWER “Splicing” is one way eukaryotic organisms like humans regulate gene expression. What is involved in the process of splicing?

CHOOSE THE BEST ANSWER What is the relationship between the terms “genotype” and “phenotype”?

CHOOSE THE BEST ANSWER The building blocks of DNA are nucleotides. The four nucleotides of DNA are commonly referred to by the first letter of its full name: A, T, C, and G. What component of a nucleotide gives its unique characteristics and corresponds to its shortened name?

CHOOSE THE BEST ANSWER FOR EACH QUESTION Researchers hypothesize that glucosamine reduces joint pain and increases agility in senior dogs. They design an experiment to test their hypothesis where they give 50 senior dogs a 1000 mg glucosamine supplement a day and another group of 50 senior dogs a placebo without glucosamine. Every day for a month, all dogs will be measured and timed on a simple agility run. Results will then be compared between groups to determine how effective the treatment was. In this experiment: what was the dependent variable? [dependent1] what was the independent variable? [independent1]

CHOOSE THE BEST ANSWER A mother and her two daughters each develop breast cancer at approximately the same age in their lives. Based on genetic analysis, it is determined that mutations in the BRCA1,  tumor suppressor gene, is responsible for all three instances of cancer. Their specific mutations are presented below (bold base pair). Mother: ATCGCTCCADaughter A: ATCGCTCCADaughter B: ATCGCTCCA Given these data, what is the most likely origin of each daughter’s cancer? Daughter A’s cancer is [answer1] Daughter B’s cancer is [answer2]

CHOOSE THE BEST ANSWERS Imagine your hair color is determined by one gene with two alleles. Both of your parents have brown hair (dominant), but you have blonde hair (recessive). What are your parents’ genotypes based on the information above?

CHOOSE THE BEST ANSWER Alleles are alternate versions of _____ gene(s) that have ____ nucleotide sequences.

CHOOSE THE BEST ANSWER Foxes The Arctic fox (Vulpes lagopus) and the fennec fox (Vulpes zerda) both belong to the same genus but inhabit vastly different environments—one in the Arctic and the other in the Sahara desert. On the other hand, the Corsac fox (Vulpes corsac) and the Cape fox (Vulpes chama) live in semi-arid habitats in Central Asia and South Africa, respectively. You sequence one gene present in all four species and obtain the following results: Arctic fox: TCGGATCAGGACTACCTAGACape fox: TTGGGTGAGGATTGCGTATACorsac fox: TCGGATCAGGACTACTTAAAFennec fox: TTGGGTGAGGATCGCATATT Based on the data, which species is most closely related to the Arctic fox?

CHOOSE THE BEST ANSWER FOR EACH QUESTION You have identified the mutation in a p53 gene responsible for an aggressive type of lung cancer. The normal template sequence is on the top, while the mutant template sequence is below. The specific mutation is shown below in red. What type of mutation is it? [answer1] What change does the mutation cause? [answer2] Normal p53 DNA Sequence: 3′ – AAT GCA AAA CCA TTG CCA – 5’Mutant p53 DNA Sequence: 3′ – AAT GCA AAT CCA TTG CCA – 5′

CHOOSE THE BEST ANSWER Zlorp is an alien world is governed by Mendelian genetics, so your hard-learned “Earth Biology” will still apply. On Zlorp, there’s a vegetable called Zulara, which a lot of Zlorpians love. Unfortunately, there’s a disease that’s sweeping through the Zulara population. Zlorpians have discovered that Zulara susceptibility to the disease is controlled by a single gene with two alleles – S (susceptible) and s (not-susceptible). A Zlorpian farmer crosses a Zulara plant with susceptible fruit (Ss) with a plant with non-susceptible fruit (ss). What is the chance that any offspring of this crossing will not be susceptible?