GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

GradePack

Here is a guide to what the following diagram means: K and…

Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  Where would the start codon be located along strand K/L? Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC

Read Details

An individual is born with a mutation such that they cannot…

An individual is born with a mutation such that they cannot form MAC proteins that associate with one another in a plasma membrane. This is an example of ________.

Read Details

In the context of meiosis, homologous chromosomes can be def…

In the context of meiosis, homologous chromosomes can be defined as ________.

Read Details

Paralytic shellfish syndrome can cause ___ due to saxitoxin,…

Paralytic shellfish syndrome can cause ___ due to saxitoxin, a potent neurotoxin. 

Read Details

Which of the following accurately describes the path travell…

Which of the following accurately describes the path travelled by a new protein as it is synthesized and released from the cell?

Read Details

What is genetic drift? 

What is genetic drift? 

Read Details

______________ are comprised on microtubules and facilitate…

______________ are comprised on microtubules and facilitate bacterial phototaxis or chemotaxis.

Read Details

You vaccinate a patient against tetanus. The tetanus vaccine…

You vaccinate a patient against tetanus. The tetanus vaccine consists of a toxoid molecule, which, when injected, causes patients to produce antibodies to the tetanus toxin. How does this occur?

Read Details

Suppose you use a match to ignite a sheet of paper from your…

Suppose you use a match to ignite a sheet of paper from your notebook and allow the fire to continue until the burning stops. If you could measure all the energy in the resulting combustion products and all the energy in the heat released, would you predict this amount to be more than, less than, or the same amount as the amount of potential energy in the starting sheet of paper? (You should ignore the activation energy provided by the match to light the paper.)

Read Details

Which virus is known for travelling through the human nervou…

Which virus is known for travelling through the human nervous system?

Read Details

Posts pagination

Newer posts 1 … 36,875 36,876 36,877 36,878 36,879 … 90,155 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top