Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?   Normal gene: ATGGCCGGCCCGAAAGAGACC          Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr          Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

4A. (8 pts) Match the definitions with the appropriate type of bias or effect shown on the right.

How many synapomorphies are on this tree? Assume the tips of this tree each represent a species.

Which of the following is directly involved in splicing mRNAs?

Which of the following is considered to be a ‘scientist stereotype’?

Bateman’s gradients can be used to understand the strength of sexual selection acting on a sex.  In snails, populations include two sexes, but those sexes can be male and hermaphrodite, female and hermaphrodite, and male and female.  In this example, the population is composed of males and hermaphrodites.  Using the graph below, who is sexual selection acting on? Note: x-axis = number of mates & y-axis = number of offspring

Microevolution involves ___

 Dandelions,  Taraxacum officinale, are plants that asexually produce fruitlike propagules. Sexual reproduction is very rare in this organism. Which species concept would be LEAST useful in defining dandelions as a species?

There are many types of Natural selection and they act on traits in different ways. Assume there is selection acting on size of a wing in a bird.  For each type of selection match what will happen to the variation in wing size among individuals in the population over time.  Hint: think about the distributions we drew in class for each of these types of natural selection.

Week 12: Levels of Selection & Sexual Selection-SHORT ANSWER (12 PTS)