Which parts of the nucleotide-excision repair mechanism assist in the physical cutting and removal of nucleotides? I.       UvrAII.      UvrBIII.     UvrCIV.     UvrD

Essay A. All four mechanisms of evolution (mutation, migration, genetic drift, and natural selection) that we have discussed influence speciation.  Choose 3 of these mechanisms and for each describe (a) whether it helps or hinders speciation (or both) and (b) why it has that particular impact on speciation.

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?   Normal gene: ATGGCCGGCCCGAAAGAGACC          Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr          Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

4A. (8 pts) Match the definitions with the appropriate type of bias or effect shown on the right.

How many synapomorphies are on this tree? Assume the tips of this tree each represent a species.

Which of the following is directly involved in splicing mRNAs?

Which of the following is considered to be a ‘scientist stereotype’?

Bateman’s gradients can be used to understand the strength of sexual selection acting on a sex.  In snails, populations include two sexes, but those sexes can be male and hermaphrodite, female and hermaphrodite, and male and female.  In this example, the population is composed of males and hermaphrodites.  Using the graph below, who is sexual selection acting on? Note: x-axis = number of mates & y-axis = number of offspring

Microevolution involves ___

 Dandelions,  Taraxacum officinale, are plants that asexually produce fruitlike propagules. Sexual reproduction is very rare in this organism. Which species concept would be LEAST useful in defining dandelions as a species?