Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  Where would the start codon be located along strand K/L? Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC

______________ are comprised on microtubules and facilitate bacterial phototaxis or chemotaxis.

In the context of meiosis, homologous chromosomes can be defined as ________.

Which of the following is not one of the major differences between RNA and DNA?

You vaccinate a patient against tetanus. The tetanus vaccine consists of a toxoid molecule, which, when injected, causes patients to produce antibodies to the tetanus toxin. How does this occur?

The C carbohydrate protein of Streptococcus pyogenes:

Which of the following is not a potential vehicle for disease transmission?

Escherichia coli bacterium doubles every 30 minutes and you have a starting inoculum of 500 colony forming units (CFU). How many colony forming units (CFU) will be present after 2 hours?

At least 56 million people globally suffer from trematodiases which can cause severe liver and lung disease, if left untreated. How is this infection acquired?

Which is false regarding Group D bacteria?