What would happen, if anything, to the mRNA sequence if the A at position 13 on the DNA sequence was changed to a G by a point mutation?  Here’s the DNA sequence again: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’

Which of the following is a structural polysaccharide?

Which type of cell junction prevents cells from pulling apart when a tissue is bent or stretched?

Which of the following components is different between amino acids?

Materials move in and out of the nucleus through the __________.

Potassium ions (K+) are attracted to Chloride ions (Cl-). What type of bond are they forming?

The nucleus of the eukaryotic cell functions: 

A threadlike structure found in both animal and bacterial cells that aids in locomotion.

When water freezes into a solid, it’s molecules are packed together ________ densely than in a liquid state.

If an element has an atomic number of 6 and a mass number of 14, how many neutrons does it have?