Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end.  Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’   Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon.   This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation.  Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]

PCR is a clever procedure.  What type of enzyme is used to make this procedure workable?  Why?  Where is this enzyme from?

Why do the DNA fingerprints of non-related individuals differ? 

All animals must get oxygen for respiration.  Which of the following is NOT involved in this critical function?

According to the phylogenetic tree below, modern-day mammals are most closely related to which modern group of reptiles?

Homeostasis in animals can be generally defined as the _____.

When scientists study organisms in nature (i.e. outside of the laboratory), carefully controlled experimentation is not always possible.  In a case involving mating behavior of birds, data might be gathered by

Evidence suggests that an asteroid struck the Gulf of Mexico near what is now the Yucatan Peninsula about 65 million years ago.  What was likely the cause of the cause of the loss of many plants?

Which organ system plays the least role in maintaining optimal conditions of the animal body? 

The lungs and heart are located in the _____.