GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

GradePack

What is a proactive tool that can be used to mitigate risk b…

What is a proactive tool that can be used to mitigate risk by identifying potential failures in a process?  

Read Details

What is the name of the program that assigns a letter grade…

What is the name of the program that assigns a letter grade to a hospital’s patient safety?  

Read Details

Ligase forms [a] bonds between 5’ phosphate groups and 3’ -O…

Ligase forms [a] bonds between 5’ phosphate groups and 3’ -OH groups in DNA.   Reverse transcriptase uses [c] as a template to form a complimentary [d] strand.   RNA polymerase binds to the [b] (write coding or non-coding) DNA strand and forms a complimentary molecule of [e], through the process of trans[f]. The monomer units of proteins are [g]

Read Details

Transcribe the following DNA sequence: (in the first and thi…

Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end.  Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’   Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon.   This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation.  Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]

Read Details

PCR is a clever procedure.  What type of enzyme is used to m…

PCR is a clever procedure.  What type of enzyme is used to make this procedure workable?  Why?  Where is this enzyme from?

Read Details

Why do the DNA fingerprints of non-related individuals diffe…

Why do the DNA fingerprints of non-related individuals differ? 

Read Details

All animals must get oxygen for respiration.  Which of the f…

All animals must get oxygen for respiration.  Which of the following is NOT involved in this critical function?

Read Details

According to the phylogenetic tree below, modern-day mammals…

According to the phylogenetic tree below, modern-day mammals are most closely related to which modern group of reptiles?

Read Details

Homeostasis in animals can be generally defined as the _____…

Homeostasis in animals can be generally defined as the _____.

Read Details

When scientists study organisms in nature (i.e. outside of t…

When scientists study organisms in nature (i.e. outside of the laboratory), carefully controlled experimentation is not always possible.  In a case involving mating behavior of birds, data might be gathered by

Read Details

Posts pagination

Newer posts 1 … 37,458 37,459 37,460 37,461 37,462 … 76,921 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top