Use the dsDNA sequence below to answer the following questions.             AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA             TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT (10a) During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5’ and 3’ ends of each strand. (2)

Below are the results of a series of experiments on fruit flies with two different phenotypes. Flies with phenotype 1 can digest rotting fruit without any problem while those with phenotype 2 have a drunken appearance and sometimes even die from eating rotting fruit. The researchers hypothesize that the two phenotypes are the result of differences in the enzyme alcohol dehydrogenase (Adh), which catabolizes the ethanol produced when fruits rot. The researchers decide to do three tests of this hypothesis. First, they do a northern blot for Adhin individuals of both phenotypes. Second, they do a western blot for Adhin individuals of both phenotypes. Finally, they sequence a portion of the 5’ end of the coding strand of the DNA of individuals of both phenotypes. The results of each are shown below.             (A.) Interpret the results of the northern and western blots.            (B.) Determine the coding sequences of the alleles of both phenotypes (label 5’ and 3’ ends).            (C.) What do you hypothesize is the cause of the different phenotypes?            (D.) What data would you need to generate to test your hypothesis?(12 points)  

A tRNA moves through the binding sites of the ribosome in what order? (3)

Match the term on the left with the correct definition on the right. (1 each)

A client has a diagnosis of GERD and is receiving omeprazole daily at bedtime and the nurse is reinforcing teaching on medication side effects. Which statement is most appropriate for the nurse to include in the teaching?

A nurse is preparing to administer dextrose 5% in water IV to infuse at 100 mL/60 min. The drop factor on the manual IV tubing is 60 gtt/mL. The nurse should set the IV flow rate to deliver how many gtt/min? 

A nurse is caring for a client who is taking cimetidine. Which of the following client statements indicates to the nurse that the cimetidine treatment has been effective? (Select all that apply.)

Which of the following is TRUE about the Arab – Israeli conflict? 9.13

Describe the process by which a prokaryotic cell makes a copy of its chromosome. (10)

The Central Dogma of Molecular Biology is used to describe the flow of genetic information within a cell. Draw a flow chart of the central dogma and identify the processes involved in each step. (3)