List two strategies that help you stay on task and control your time.

What are four criteria you should use to evaluate the accuracy of information located on the web?

Imagine that you have just graduated from college and are exploring various job opportunities. You have researched what each job involves, how likely you are to get it, and how the different workplaces compare with each other. What strategies might you use to make a final decision about which job to apply for?

In the “Prepare” section of Chapter 5, the text discusses a number of ways that you can prepare for tests. Please discuss, in your own words and with examples, three of the recommended strategies.

In your first year of college if you begin to feel lonely, which of the following techniques will help you deal with your loneliness? Click all that apply.

Although credit cards can be useful for emergencies, they should be used with caution in other situations. Which of the following are reasons for using credit cards with caution? Click all that apply.

What is a proactive tool that can be used to mitigate risk by identifying potential failures in a process?  

What is the name of the program that assigns a letter grade to a hospital’s patient safety?  

Ligase forms [a] bonds between 5’ phosphate groups and 3’ -OH groups in DNA.   Reverse transcriptase uses [c] as a template to form a complimentary [d] strand.   RNA polymerase binds to the [b] (write coding or non-coding) DNA strand and forms a complimentary molecule of [e], through the process of trans[f]. The monomer units of proteins are [g]

Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end.  Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’   Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon.   This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation.  Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]