GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

GradePack

The mRNA sequence below contains nucleotides that encode the…

The mRNA sequence below contains nucleotides that encode the first amino acids of the protein made by the nuclear fallout (nuf) gene in Drosophila: 5’-GUAAAUCAUGAGUAGUCAACCUGCCAGC…-3’        wildtype nuf mRNA  What are the first five amino acids encoded by this mRNA (use three letter abreviations given in the codon table below)?     You isolate a nuf gene mutant and determine the base sequence of the mutant mRNA: 5’- GUAAAUCAUGAGUAGUAAACCUGCCAGC…-3’        mutant nuf mRNA What are the first five amino acids encoded by this mRNA (use codon table below)?    Is the mutation in the gene a transition, transversion, insertion, or deletion?    In the wildtype sequence below, identify a single base pair change that would lead to an early stop (nonsense mutation). Which nucleotide would you change (A-E)? What nucleotide would you change it to (A, T, G or C)?          

Read Details

You find a bounding carotid pulse on a 62-year-old patient….

You find a bounding carotid pulse on a 62-year-old patient. Which murmur should you search out?

Read Details

The article presents identity as deeply connected to ancestr…

The article presents identity as deeply connected to ancestry and cultural memory.

Read Details

Harjo’s description of the current moment as a “transformati…

Harjo’s description of the current moment as a “transformational emergency” suggests that:

Read Details

You are screening people at the mall as part of a health fai…

You are screening people at the mall as part of a health fair. The first person who comes for screening has a blood pressure of 132/85. How would you categorize this?

Read Details

The grandfather’s presence in Harjo’s poem primarily represe…

The grandfather’s presence in Harjo’s poem primarily represents:

Read Details

A patient comes to you because she is experiencing a tremor…

A patient comes to you because she is experiencing a tremor only when she reaches for things. This becomes worse as she nears the “target.” When you ask her to hold out her hands, no tremor is apparent. What type of tremor does this most likely represent?

Read Details

Which of the following diagnoses should be on the provider’s…

Which of the following diagnoses should be on the provider’s differential list in an adult patient with complaints of weight gain?

Read Details

A 21-year-old engineering student comes to your office, comp…

A 21-year-old engineering student comes to your office, complaining of leg and back pain and of tripping when he walks. He states this started 3 months ago with back and buttock pain but has since progressed to feeling weak in his left leg. He denies any bowel or bladder symptoms. He can think of no specific traumatic incidences but he was a defensive lineman in high school and junior college. His past medical history is unremarkable. He denies tobacco use or alcohol or drug abuse. His parents are both healthy. On examination he is tender over the lumbar spine and he has a positive straight-leg raise on the left. His Achilles tendon deep reflex is decreased on the left. While watching his gait you notice he has to pick his left foot up high in order not to trip.What abnormality of gait does he most likely have?

Read Details

Which of the following diagnoses is important to consider in…

Which of the following diagnoses is important to consider in the diagnostic evaluation of fatigue?

Read Details

Posts pagination

Newer posts 1 2 3 4 5 6 … 84,498 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top