The remaining questions refer to the following DNA sequence:…
The remaining questions refer to the following DNA sequence: 3’AAATTCACCTACATGGCGTTGCGCGAATGCTAGAATACCGCTCTCATTAGAAATCAAATC 5’ You will need to transcribe and translate the DNA sequence to answer these questions. You should CAREFULLY write down this sequence on a piece of scrap paper so you can do the transcription and translation. A BIOL 190 student transcribed the DNA sequence above and gave an answer of: TTTAAGTGGATGTACCGCAACGCGCTTACGATCTTATGGCGAGAGTAATCTTTAGTTTAG Is this correct?
Read Details