CHOOSE THE BEST ANSWER Alleles are alternate versions of _____ gene(s) that have ____ nucleotide sequences.

CHOOSE THE BEST ANSWER Foxes The Arctic fox (Vulpes lagopus) and the fennec fox (Vulpes zerda) both belong to the same genus but inhabit vastly different environments—one in the Arctic and the other in the Sahara desert. On the other hand, the Corsac fox (Vulpes corsac) and the Cape fox (Vulpes chama) live in semi-arid habitats in Central Asia and South Africa, respectively. You sequence one gene present in all four species and obtain the following results: Arctic fox: TCGGATCAGGACTACCTAGACape fox: TTGGGTGAGGATTGCGTATACorsac fox: TCGGATCAGGACTACTTAAAFennec fox: TTGGGTGAGGATCGCATATT Based on the data, which species is most closely related to the Arctic fox?

CHOOSE THE BEST ANSWER FOR EACH QUESTION You have identified the mutation in a p53 gene responsible for an aggressive type of lung cancer. The normal template sequence is on the top, while the mutant template sequence is below. The specific mutation is shown below in red. What type of mutation is it? [answer1] What change does the mutation cause? [answer2] Normal p53 DNA Sequence: 3′ – AAT GCA AAA CCA TTG CCA – 5’Mutant p53 DNA Sequence: 3′ – AAT GCA AAT CCA TTG CCA – 5′

CHOOSE THE BEST ANSWER Zlorp is an alien world is governed by Mendelian genetics, so your hard-learned “Earth Biology” will still apply. On Zlorp, there’s a vegetable called Zulara, which a lot of Zlorpians love. Unfortunately, there’s a disease that’s sweeping through the Zulara population. Zlorpians have discovered that Zulara susceptibility to the disease is controlled by a single gene with two alleles – S (susceptible) and s (not-susceptible). A Zlorpian farmer crosses a Zulara plant with susceptible fruit (Ss) with a plant with non-susceptible fruit (ss). What is the chance that any offspring of this crossing will not be susceptible?

Digital Exams and Scholastic Dishonesty Copying, photographing, and distributing exam materials, as well as using digital learning tools (e.g., AI tools), violates the University’s policy of Scholastic Dishonesty. Consequences include failing the exam, failing the course, and administrative probation. To discourage such behavior, each student will receive a unique exam in terms of its wording and composition. This is a fair warning that if you distribute material from the exam, there is a high probability that it can be traced back to you. Exams will otherwise be equivalent in terms of length, content, and difficulty.  

CHOOSE THE BEST ANSWER What molecule is the physical link between the codon in the mRNA and its corresponding amino acid?

CHOOSE THE BEST ANSWER FOR EACH QUESTION Researchers hypothesize that chondroitin reduces joint pain and increases agility in senior dogs. They design an experiment to test their hypothesis where they give 100 senior dogs a 500 mg chondroitin supplement a day and another group of 100 senior dogs a placebo without chondroitin. Every day for a month, all dogs will be measured and timed on a simple agility run. Results will then be compared between groups to determine how effective the treatment was. In this experiment: what was the dependent variable? [dependent1] what was the independent variable? [independent1]

(a) (2 points) What is penetration testing? (b) (4 points) What does it mean to be “stealthy” during a penetration testing? (c) (4 points) What are the benefits of penetration testing?

Consider the following program. What the possible outcomes from running this function? Check all that apply (note that the outcomes shown are not exhaustive).

If c is of type int* and b is of type int, c[b] is equivalent to *c+b.