GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

GradePack

In the “Prepare” section of Chapter 5, the text discusses a…

In the “Prepare” section of Chapter 5, the text discusses a number of ways that you can prepare for tests. Please discuss, in your own words and with examples, three of the recommended strategies.

Read Details

In your first year of college if you begin to feel lonely, w…

In your first year of college if you begin to feel lonely, which of the following techniques will help you deal with your loneliness? Click all that apply.

Read Details

Although credit cards can be useful for emergencies, they sh…

Although credit cards can be useful for emergencies, they should be used with caution in other situations. Which of the following are reasons for using credit cards with caution? Click all that apply.

Read Details

What is a proactive tool that can be used to mitigate risk b…

What is a proactive tool that can be used to mitigate risk by identifying potential failures in a process?  

Read Details

What is the name of the program that assigns a letter grade…

What is the name of the program that assigns a letter grade to a hospital’s patient safety?  

Read Details

Ligase forms [a] bonds between 5’ phosphate groups and 3’ -O…

Ligase forms [a] bonds between 5’ phosphate groups and 3’ -OH groups in DNA.   Reverse transcriptase uses [c] as a template to form a complimentary [d] strand.   RNA polymerase binds to the [b] (write coding or non-coding) DNA strand and forms a complimentary molecule of [e], through the process of trans[f]. The monomer units of proteins are [g]

Read Details

Transcribe the following DNA sequence: (in the first and thi…

Transcribe the following DNA sequence: (in the first and third blank, indicate 3′ or 5′ end.  Enter the transcript in all caps in the center blank.) 3′ TATGCTACCCGTATCATCTTTACCTCCGATTGCGTACTAA 5′ [a]’ [b] [c]’   Use the codon chart to translate your transcript. Begin translating at AUG and stop when you reach the stop codon.   This is the biologically-significant way that translation works and if you do not do this, you will not receive credit for your translation.  Please separate the amino acid abbreviations with hyphens – i.e. cys-ala-thr-stop [d]

Read Details

PCR is a clever procedure.  What type of enzyme is used to m…

PCR is a clever procedure.  What type of enzyme is used to make this procedure workable?  Why?  Where is this enzyme from?

Read Details

Why do the DNA fingerprints of non-related individuals diffe…

Why do the DNA fingerprints of non-related individuals differ? 

Read Details

All animals must get oxygen for respiration.  Which of the f…

All animals must get oxygen for respiration.  Which of the following is NOT involved in this critical function?

Read Details

Posts pagination

Newer posts 1 … 43,680 43,681 43,682 43,683 43,684 … 83,143 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top