For the following Free response consider this the template strand: 5′ CTTAGAGTCCTCAGTCCACGTGCATGT 3′

The major pigment used in photosynthesis is

DNA replication  is best described as

The site of glycolysis is the

The enzyme associated with transcription is

By which process do prokaryotic cells divide to produce two identical daughter cells?

Making a copy of DNA using a DNA template is known as

What is  the main enzyme for DNA replication?

How many possible codons are there?

the spontaneous movement of a substance from a high concentration to a low concentration is referred to as