Which of the following is a small infectious agent that replicates only inside of living cells?

What would you conclude if you came across an organism and evaluated its ratio of nucleotides and found these ratios? Ratio of Nucleotides Nucleotide 1 Nucleotide 2 Ratio A T 0.574 A C 0.345 A G 1.02 T C 0.992 T G 0.349 C G 0.567  

Utilizing Chargaff’s rules, if you sequenced a genome and determined that 13% of the genome were thymine nucleotides, what percentage would be guanine nucleotides?

Which of these summarizes the overall reactions of cellular respiration?

Cilia are part of the protective barrier located in the ________.

A man is scratched by his cat. A phagocyte near the scratch site recognizes and engulfs a bacterium. Shortly thereafter, more phagocytes arrive in the tissue surrounding the scratch.  How are the additional phagocytes recruited to the site of the scratch?

Genetic diversity among organisms is increased by which process?

The active maintenance of a constant environment is referred to as ________.

Endogenous infectious agents arise from microbes that are:

Here is a guide to what the following diagram means: K and L are both strands of double-stranded DNA. A, B, C, and D represent mRNA transcripts. E, F, J, and G are specific locations along strand K/L. H and I don’t refer to DNA at all; they refer to directions (the direction that the arrow is pointing).  What direction would be considered upstream? (This DNA is written according to standard conventions.) Image Description (Starting at the top and going down.) H with an arrow to the left and I with an arrow to the right. Double-stranded DNA: K GCCGTA(E)TAATGCATA(F)CATCA(J)TGCGACTTAGGGTTTCT(G)AAGTCAACAGTTATT K L CGGCAT(E)ATTACGTAT(F)GTAGT(J)ACGCTGAATCCCAAAGA(G)TTCAGTTGTCAATAA L mRNA transcripts: A GCCGUAUAAUGCAUACAUCAUGCGACUUAGGGUUUCUAAGUCAACAGUUAUU B CGGCAUAUUACGUAUGUAGUACGCUGAAUCCCAAAGAUUCAGUUGUCAAUAA C UUAUUGACAACUGAAUCUUUGGGAUUCAGCGUACUACAUACGUAAUAUGCCG D AAUAACUGUUGACUUAGAAACCCUAAGUCGCAUGAUGUAUGCAUUAUACGGC