Note: Show your calculations clearly on the paper and show your work clearly on the graph or else you will lose points! Given the phase diagram below: At 10 w.% Cu, indicate on the phase diagram what phases are present at 600 °C. At 10 w.% Cu, to the best of your ability, estimate the composition of all of the phases present at 600 °C Sketch the microstructures and write the names of the phases present at the numbered points.  

Briefly define the following terms, concepts or rules using words, equations, and/or sketches: Van der Waals bond

How does a mRNA molecule in E. coli bind in the correct location of a ribosome? (3)

Ribose is a

(7a) You insert cDNA from the killifish Fundulus heteroclitus into expression vectors containing a bacterial promoter and then transform E. coli cells with these recombinant vectors. You use an antibody for the killifish protein Superoxide Dismutase to screen the colonies. Would this work to find the colony transformed with the gene for Superoxide Dismutase?  Why or why not? (3)

Body centered cubic (BCC) crystal structures follow the ABCABCABC… packing sequence.

Index the illustrated directions in the unit cubic cell drawn below.  

A carbohydrate with 6 carbons and a ketone functional group is called

Use the dsDNA sequence below to answer the following questions.             AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA             TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT (10a) During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5’ and 3’ ends of each strand. (2)

Below are the results of a series of experiments on fruit flies with two different phenotypes. Flies with phenotype 1 can digest rotting fruit without any problem while those with phenotype 2 have a drunken appearance and sometimes even die from eating rotting fruit. The researchers hypothesize that the two phenotypes are the result of differences in the enzyme alcohol dehydrogenase (Adh), which catabolizes the ethanol produced when fruits rot. The researchers decide to do three tests of this hypothesis. First, they do a northern blot for Adhin individuals of both phenotypes. Second, they do a western blot for Adhin individuals of both phenotypes. Finally, they sequence a portion of the 5’ end of the coding strand of the DNA of individuals of both phenotypes. The results of each are shown below.             (A.) Interpret the results of the northern and western blots.            (B.) Determine the coding sequences of the alleles of both phenotypes (label 5’ and 3’ ends).            (C.) What do you hypothesize is the cause of the different phenotypes?            (D.) What data would you need to generate to test your hypothesis?(12 points)