During which part of the cell cycle is DNA replicated?

5’ – UUCGAUGAGAGCGGAGUGAUUGAUUAA– 3’ Which of the following would be the result of translating the sequence seen above?  

Cells that divide uncontrollably and invade neighboring tissues are called

35). Two parents are each homozygous dominant at the cystic fibrous gene. What is the probability that their first child will have cystic fibrosis?

You want to prepare 100 plates containing 1% LB agar to run your experiment.   How much stock solution would you need to make 100 mL of a 1% solution from your 4% stock solution?

18). Structure leads to                                    .

38). The diagram that is used to determine the possibilities of offspring having particular genotypes, given the genotypes of the parents, is a(n) _____.

The first step of this experiment is to prepare a solution of LB agar. It is easier to make a concentrated stock solution and then dilute it to make the agar plates.   How many grams of LB agar would you need to make 400 mL of a 3% solution?

You need to use a micropipette to add the LB agar to each of the plates.   Each plate needs to contain 0.6 mL of the LB agar, but the micropipette measures volumes in microliters (ul). How many ul are in 0.6 mL?  

A protein is made up of a chain of_________.