What is genetic engineering? In general, how are genetically modified organisms made? (5 pts)

Consider the following sequence and explain what effect the mutation has on the protein that is translated.   UCUAUGUUUCACAGAGGGAAACCCUAACCC (normal)   UCUAUGUUUCACAGCGGGAAACCCUAACCC (mutant)

The two strands of a chromosome double helix are joined to each other through _____.

Portions of mRNA called __________ are removed and the remaining __________ are spliced together to produce an mRNA molecule with a continuous coding sequence.

Most human cancers are _____.

What controls the way in which a zygote differentiates (divides and specializes into different cell and tissue types)?

Promoters are:

Insulin used for the treatment of diabetes in humans is now obtained from _____.

What nucleotide sequence would be found on the complementary DNA strand of the strand shown here?

Explain the role of proto-oncogenes and tumor-suppressor genes in cancer. (5 pts)