Below is a figure of the phylogenetic relationships between…
Below is a figure of the phylogenetic relationships between a group of coronaviruses. In the figure, coronaviruses that infect human beings and cause the common cold are highlighted in orange, and human-infecting SARS viruses are highlighted in red. Figure is from Nature Microbiology 5: 536–544(2020). Based on this data, Is the following statement True or False? The closest relative to MERS-CoV is EriCoV.
Read DetailsConsider the following mRNA sequence, where the underlined A…
Consider the following mRNA sequence, where the underlined AUG indicates a start codon for translation: 5′ AAAAUGGUCCUCGGCUCGCUAUCA 3′ When the GGC codon is in the A site, what codon will be in the P site? For your answer, write only the codon in the blank, written from 5′ to 3′ direction, but do NOT add 5′ or 3′ or any punctuation. So your answer should just be something like : GGG
Read Details