Identify  the disaccharide from the following list

(10d) Imagine there is a mutation in the 14th base from the left where instead of a A top/ T bottom pair you now have an C top / G bottom pair. How will this change the protein encoded? (3)             AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA             TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT

(10c) What is the amino acid sequence of the protein encoded by this gene? (3)             AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA             TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT

The nitrogenous bases of RNA and DNA nucleotides fall into two chemical categories. What are those categories and list which category each base belongs in. (4)

Which three of these are required elements for a valid, enforceable deed?

Land use markets suffer economic failure due to which three causes?

In addition to standard requirements for a valid contract, a contract for sale and purchase of real estate requires which two of these elements?

When a local zoning ordinance is implemented, land uses that predate enactment of the ordinance must be allowed to remain, subject to certain restrictions. This requirement is known as provision for:

Property rights have which three of these elements?

#12