(10d) Imagine there is a mutation in the 14th base from the…
(10d) Imagine there is a mutation in the 14th base from the left where instead of a A top/ T bottom pair you now have an C top / G bottom pair. How will this change the protein encoded? (3) AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT
Read Details