GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

GradePack

Ribose is a

Ribose is a

Read Details

(7a) You insert cDNA from the killifish Fundulus heteroclitu…

(7a) You insert cDNA from the killifish Fundulus heteroclitus into expression vectors containing a bacterial promoter and then transform E. coli cells with these recombinant vectors. You use an antibody for the killifish protein Superoxide Dismutase to screen the colonies. Would this work to find the colony transformed with the gene for Superoxide Dismutase?  Why or why not? (3)

Read Details

Body centered cubic (BCC) crystal structures follow the ABCA…

Body centered cubic (BCC) crystal structures follow the ABCABCABC… packing sequence.

Read Details

Index the illustrated directions in the unit cubic cell draw…

Index the illustrated directions in the unit cubic cell drawn below.  

Read Details

A carbohydrate with 6 carbons and a ketone functional group…

A carbohydrate with 6 carbons and a ketone functional group is called

Read Details

Use the dsDNA sequence below to answer the following questio…

Use the dsDNA sequence below to answer the following questions.             AAATTCGCATTCGAATGCGGGCGGCTTAGCAATAGACGAAGGTGTAACCA             TTTAAGCGTAAGCTTACGCCCGCCGAATCGTTATCTGCTTCCACATTGGT (10a) During replication, the replication fork moves through this sequence from left to right and the complement to the bottom strand is synthesized in fragments. Label the 5’ and 3’ ends of each strand. (2)

Read Details

Below are the results of a series of experiments on fruit fl…

Below are the results of a series of experiments on fruit flies with two different phenotypes. Flies with phenotype 1 can digest rotting fruit without any problem while those with phenotype 2 have a drunken appearance and sometimes even die from eating rotting fruit. The researchers hypothesize that the two phenotypes are the result of differences in the enzyme alcohol dehydrogenase (Adh), which catabolizes the ethanol produced when fruits rot. The researchers decide to do three tests of this hypothesis. First, they do a northern blot for Adhin individuals of both phenotypes. Second, they do a western blot for Adhin individuals of both phenotypes. Finally, they sequence a portion of the 5’ end of the coding strand of the DNA of individuals of both phenotypes. The results of each are shown below.             (A.) Interpret the results of the northern and western blots.            (B.) Determine the coding sequences of the alleles of both phenotypes (label 5’ and 3’ ends).            (C.) What do you hypothesize is the cause of the different phenotypes?            (D.) What data would you need to generate to test your hypothesis?(12 points)  

Read Details

A tRNA moves through the binding sites of the ribosome in wh…

A tRNA moves through the binding sites of the ribosome in what order? (3)

Read Details

Match the term on the left with the correct definition on th…

Match the term on the left with the correct definition on the right. (1 each)

Read Details

A client has a diagnosis of GERD and is receiving omeprazole…

A client has a diagnosis of GERD and is receiving omeprazole daily at bedtime and the nurse is reinforcing teaching on medication side effects. Which statement is most appropriate for the nurse to include in the teaching?

Read Details

Posts pagination

Newer posts 1 … 62,612 62,613 62,614 62,615 62,616 … 81,811 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top