GradePack

    • Home
    • Blog
Skip to content
bg
bg
bg
bg

GradePack

The proper term for milk secretion is:

The proper term for milk secretion is:

Read Details

The male ductal elements usually remain small but can hypert…

The male ductal elements usually remain small but can hypertrophy during puberty, as well as later in life, under the influence of hormonal fluctuations, disease processes, or medications.  This condition is called:

Read Details

A milky cyst caused by an obstruction of the lactiferous duc…

A milky cyst caused by an obstruction of the lactiferous duct in a lactating or pregnant patient is called:

Read Details

Which imaging guided procedure is done immediately before su…

Which imaging guided procedure is done immediately before surgery to help the surgeon find a lesion?

Read Details

42.  Use the sequence below to answer the following question…

42.  Use the sequence below to answer the following questions.  5′ AUGUGGACAGAUAGCUGGGGCAAAAAAUGAAAAAAAAAA 3′  If the second codon above, UGG, was changed to UGA, what type of mutation would this be? 

Read Details

A 22 y/o F presents to the ultrasound department with a palp…

A 22 y/o F presents to the ultrasound department with a palpable breast mass.   You perform a breast sonogram , you find this mass at RT 2:00 3CM FN.  The patient requests a biopsy due to a strong family history of breast CA.  The mass is biopsied and the tissue comes back as the most common solid benign breast mass. A) What was the mass? (1 point) B) List three (3) sonographic characteristics that are more commonly benign sonographic findings in the above breast mass: (3 points)

Read Details

A majority of breast cancers arise from what structure?

A majority of breast cancers arise from what structure?

Read Details

43. FREE POINT! =)  Select the FREE POINT below! 

43. FREE POINT! =)  Select the FREE POINT below! 

Read Details

Which of the following is not a characteristic of a simple c…

Which of the following is not a characteristic of a simple cyst?

Read Details

A hamartoma is also called:

A hamartoma is also called:

Read Details

Posts pagination

Newer posts 1 … 63,761 63,762 63,763 63,764 63,765 … 86,189 Older posts

GradePack

  • Privacy Policy
  • Terms of Service
Top