Sonographically, fat appears _________________________ than the glandular tissue of the breast.

Sonography may be used to differentiate between cystic and solid breast masses.

Mammography is the modality of choice, in the general population, to screen for breast malignancy.

What structures connect the fascia around the ducts and glands to the skin and give the breast support and structure?

A 64 y/o F presents to the ultrasound department with a palpable breast mass.   You perform a breast sonogram , you find this mass at LT 4:00 2CM FN.  The radiologist suggests a biopsy.    The mass is biopsied and the tissue comes back as the most common breast cancer. A) What was the mass? (1 point) B) List three (3) sonographic characteristics that suggest malignancy in the above image: (3 points)  

The proper term for milk secretion is:

The male ductal elements usually remain small but can hypertrophy during puberty, as well as later in life, under the influence of hormonal fluctuations, disease processes, or medications.  This condition is called:

A milky cyst caused by an obstruction of the lactiferous duct in a lactating or pregnant patient is called:

Which imaging guided procedure is done immediately before surgery to help the surgeon find a lesion?

42.  Use the sequence below to answer the following questions.  5′ AUGUGGACAGAUAGCUGGGGCAAAAAAUGAAAAAAAAAA 3′  If the second codon above, UGG, was changed to UGA, what type of mutation would this be?