For a given gene, both strands of a DNA are used as a template simultaneously from one initiation point when which of the following molecules is synthesized?

Which of the following molecules is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil?

Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start.

A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, how many 3´ hydroxyls are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

Which of the following statements is TRUE of DNA polymerases of eukaryotic cells?

In the diagram below, which letter indicates the 5’ end of the leading strand?  

What types of bonds are created between adjacent ribonucleotides during the process of transcription?

Indicate which of the following statements is TRUE.

A normal chromosome in a higher eukaryotic species would NOT be expected to contain: