Prokaryotic promoters contain the sequence TATAAT at a position _____ from the transcription start.

A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, how many 3´ hydroxyls are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

Which of the following statements is TRUE of DNA polymerases of eukaryotic cells?

In the diagram below, which letter indicates the 5’ end of the leading strand?  

What types of bonds are created between adjacent ribonucleotides during the process of transcription?

Indicate which of the following statements is TRUE.

A normal chromosome in a higher eukaryotic species would NOT be expected to contain:

Assume a DNA molecular, with the primary structure listed below, has the expected secondary structure for biological DNA in a cell.  In this double stranded DNA molecule, there are 11 Ts, 12 Cs, 12 Gs, and 11 As.  How many purines are present? ​ 5’AATAGCGGATGCCCGAATACGAG 3’TTATCGCCTACGGGCTTATGCTC

Hershey and Chase conducted experiments using radioactive isotopes to label DNA and protein in separate bacteriophage cultures and track if each molecule was transferred into infected cells with the genetic material of the phage.  Upon removal of bacteriophage coats from infected bacterial cells, where was the label for the DNA? What isoptope was used to label the DNA?